Regulon of HrcA in Saccharomonospora viridis DSM 43017

Properties
Regulator type:	Transcription factor
TF locus tag:	Svir_13540
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 47 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -203 Score: 6.6 Sequence: CTTGCACTCTCACCCTGAGAGTGCTAA Position: -168 Score: 6.9 Sequence: TTGGCACTCGGCACCGTCGAGTGCTAG Locus tag: Svir_34390 Name: groL2 Funciton: Heat shock protein 60 family chaperone GroEL
	Svir_34390	groL2	Heat shock protein 60 family chaperone GroEL
Position: -72 Score: 6.6 Sequence: TTAGCACTCTCGGCAATCGAGTGCCAG Locus tag: Svir_32690 Name: COG2331 Funciton: Conserved hypothetical protein
	Svir_32690	COG2331	Conserved hypothetical protein
Position: -133 Score: 6.6 Sequence: CTAGCACTCAGCTGGCTAGAGTGCTAA Locus tag: Svir_04660 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Svir_04670 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Svir_04660	groS	Heat shock protein 60 family co-chaperone GroES
	Svir_04670	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD