Regulon of NrtR in Frankia sp. CcI3

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 4.9 Sequence: TTAGAGTCTCATCGACCATTC Locus tag: Francci3_3122 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-)
	Francci3_3122	nadA	Quinolinate synthetase (EC 4.1.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD