Regulon of YhcF in Clostridium scindens ATCC 35704

Properties
Regulator type:	Transcription factor
TF locus tag:	CLOSCI_00067
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-3
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 6.3 Sequence: ATTGTACTAAGTTTATAATACAGT Locus tag: CLOSCI_01184 Name: BLAHAN_01094 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CLOSCI_01183 Name: BLAHAN_01093 Funciton: ABC-type multidrug transport system, permease component
	CLOSCI_01184	BLAHAN_01094	ABC-type multidrug transport system, ATPase component
	CLOSCI_01183	BLAHAN_01093	ABC-type multidrug transport system, permease component
Position: -49 Score: 6.1 Sequence: ATTGTACTATATAGATAATACAAC Locus tag: CLOSCI_00067 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: CLOSCI_00066 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CLOSCI_00065 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	CLOSCI_00067	yhcF	Transcriptional regulator, GntR family
	CLOSCI_00066	yhcG	ABC-type multidrug transport system, ATPase component
	CLOSCI_00065	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD