Regulon of SPO0590 in Roseovarius nubinhibens ISM

Properties
Regulator type:	Transcription factor
TF locus tag:	ISM_05005
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SPO0590 - Rhodobacterales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 6.2 Sequence: AAATGTAAGCGCTTGCAATA Position: -86 Score: 6.5 Sequence: CCATGCAAGCGCTTACATTG Locus tag: ISM_05010 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: ISM_05015 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: ISM_05020 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: ISM_05025 Name: usp Funciton: Universal stress family protein
	ISM_05010	hisD1	putative histidinol dehydrogenase
	ISM_05015	gno	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	ISM_05020	sdh	Sorbitol dehydrogenase (EC 1.1.1.14)
	ISM_05025	usp	Universal stress family protein
Position: -102 Score: 6.5 Sequence: CAATGTAAGCGCTTGCATGG Position: -79 Score: 6.2 Sequence: TATTGCAAGCGCTTACATTT Locus tag: ISM_05005 Name: SPO0590 Funciton: Transcriptional regulator, LacI family
	ISM_05005	SPO0590	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD