Regulon of Arth_2426 in Janibacter sp. HTCC2649

Properties
Regulator type:	Transcription factor
TF locus tag:	JNB_06194
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Arth_2426 - Micrococcineae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -137 Score: 5.4 Sequence: TGCGGAGAGCGCTTTCCGCT Locus tag: JNB_06194 Name: Arth_2426 Funciton: Sugar utilization transctriptional regulator, LacI family
	JNB_06194	Arth_2426	Sugar utilization transctriptional regulator, LacI family
Position: -61 Score: 5.4 Sequence: AGCGGAAAGCGCTCTCCGCA Locus tag: JNB_06199 Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, transmembrane component Locus tag: JNB_06204 Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, substrate-binding component Locus tag: JNB_06209 Name: null Funciton: Hydroxymethylpyrimidine ABC transporter, ATPase component Locus tag: JNB_06214 Name: SCO2752 Funciton: Predicted glucose-fructose oxidoreductase Locus tag: JNB_06219 Name: SCO2751 Funciton: Conserved hypothetical protein, potentially related to sugar utilization Locus tag: JNB_06224 Name: SCO2750 Funciton: Predicted sugar phosphate isomerases/epimerase
	JNB_06199		Hydroxymethylpyrimidine ABC transporter, transmembrane component
	JNB_06204		Hydroxymethylpyrimidine ABC transporter, substrate-binding component
	JNB_06209		Hydroxymethylpyrimidine ABC transporter, ATPase component
	JNB_06214	SCO2752	Predicted glucose-fructose oxidoreductase
	JNB_06219	SCO2751	Conserved hypothetical protein, potentially related to sugar utilization
	JNB_06224	SCO2750	Predicted sugar phosphate isomerases/epimerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD