Regulon of Caur_3587 in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_3868
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.6 Sequence: ATATTGACAATCTTCAATAT Locus tag: Chy400_3868 Name: Caur_3587 Funciton: transcriptional regulator, ArsR family
	Chy400_3868	Caur_3587	transcriptional regulator, ArsR family
Position: -43 Score: 6 Sequence: ATATCGATGATCTTCGATAT Locus tag: Chy400_3867 Name: PF07992 Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: Chy400_3866 Name: MFS Funciton: transporter, major facilitator superfamily (MFS) Locus tag: Chy400_3865 Name: PF07992 Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Chy400_3867	PF07992	FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Chy400_3866	MFS	transporter, major facilitator superfamily (MFS)
	Chy400_3865	PF07992	FAD-dependent pyridine nucleotide-disulphide oxidoreductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD