Regulon of AcrR in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_0269
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Regulog:	AcrR - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - TetR
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 6.3 Sequence: ACTCCTTACCGACCGGTAAGGAAA Locus tag: Rcas_2058 Name: Cagg_0420 Funciton: Multidrug transporter, MFS superfamily
	Rcas_2058	Cagg_0420	Multidrug transporter, MFS superfamily
Position: -86 Score: 6.7 Sequence: ATTCCTGACCGTTCGGTAAAGTGA Locus tag: Rcas_0269 Name: acrR Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family Locus tag: Rcas_0268 Name: acrA Funciton: Probable multidrug efflux system from RND family, membrane fusion protein Locus tag: Rcas_0267 Name: salX Funciton: ABC transporter related protein SalX Locus tag: Rcas_0266 Name: salY Funciton: Putative cell division protein SalY
	Rcas_0269	acrR	Predicted transcriptional regulator of multidrug efflux transporter, TetR family
	Rcas_0268	acrA	Probable multidrug efflux system from RND family, membrane fusion protein
	Rcas_0267	salX	ABC transporter related protein SalX
	Rcas_0266	salY	Putative cell division protein SalY

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD