Regulon of ScrR in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_3236
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -185 Score: 5.6 Sequence: TTAGGTTAACGTTAACATCG Locus tag: PFL_3239 Name: scrY Funciton: Sucrose-specific outer membrane porin
	PFL_3239	scrY	Sucrose-specific outer membrane porin
Position: -42 Score: 5.6 Sequence: CGATGTTAACGTTAACCTAA Locus tag: PFL_3238 Name: cscB Funciton: Sucrose permease, major facilitator superfamily Locus tag: PFL_3237 Name: cscA Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: PFL_3236 Name: scrR Funciton: Sucrose utilization transcriptional regulator, LacI family
	PFL_3238	cscB	Sucrose permease, major facilitator superfamily
	PFL_3237	cscA	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	PFL_3236	scrR	Sucrose utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD