Regulon of SuxR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type:	Transcription factor
TF locus tag:	XCC3356
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	SuxR - Xanthomonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 7.1 Sequence: CGTTACAATCGATTGCAAAG Locus tag: XCC3357 Name: sut1 Funciton: Sucrose transport protein SUT1
	XCC3357	sut1	Sucrose transport protein SUT1
Position: -190 Score: 7.1 Sequence: CTTTGCAATCGATTGTAACG Locus tag: XCC3358 Name: omp_suc Funciton: Predicted sucrose-specific outer membrane transporter, TonB-dependent Locus tag: XCC3359 Name: ams Funciton: Amylosucrase
	XCC3358	omp_suc	Predicted sucrose-specific outer membrane transporter, TonB-dependent
	XCC3359	ams	Amylosucrase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD