Regulon of MalR1 in Clostridium butyricum 5521

Properties
Regulator type:	Transcription factor
TF locus tag:	CBY_3499
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR1 - Clostridia-1
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 6.3 Sequence: GAACGGTACCGTTACCGAAT Locus tag: CBY_3499 Name: malR1 Funciton: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family Locus tag: CBY_3498 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: CBY_3497 Name: glgP Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
	CBY_3499	malR1	Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
	CBY_3498	malQ	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	CBY_3497	glgP	Maltodextrin phosphorylase (EC 2.4.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD