Regulon of ManR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC1555
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR - Xanthomonadales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 6.3 Sequence: TAATTGGATCGATCCAATTT Locus tag: XAC1555 Name: manR Funciton: Mannose utilization transcriptional regulator ManR, LacI family Locus tag: XAC1556 Name: manP Funciton: Predicted mannose transporter, GGP family Locus tag: XAC1557 Name: manK2 Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) Locus tag: XAC1558 Name: manI2 Funciton: D-mannose isomerase (EC 5.3.1.7)
	XAC1555	manR	Mannose utilization transcriptional regulator ManR, LacI family
	XAC1556	manP	Predicted mannose transporter, GGP family
	XAC1557	manK2	Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
	XAC1558	manI2	D-mannose isomerase (EC 5.3.1.7)
Position: -229 Score: 5.5 Sequence: GCATTAGAACGATCTAATCG Position: -117 Score: 4.9 Sequence: TCGTTGGATCGATACAAAGC Locus tag: XAC1910 Name: omp(Man) Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
	XAC1910	omp(Man)	Mannosides-regulated TonB-dependent outer membrane receptor
Position: -302 Score: 5.7 Sequence: AGTTTAGATCGATCCAAGCC Locus tag: XAC4355 Name: mnnA Funciton: Alpha-1,2-mannosidase
	XAC4355	mnnA	Alpha-1,2-mannosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD