Regulon of SMb21706 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b18600
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21706 - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 6.7 Sequence: ATGAGAAAACGTTTTCTCAT Locus tag: NGR_b18600 Name: SMb21706 Funciton: Transcriptional regulator, LacI family Locus tag: NGR_b18590 Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein
	NGR_b18600	SMb21706	Transcriptional regulator, LacI family
	NGR_b18590	SMb20634	sugar ABC transporter, periplasmic solute-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD