Regulon of ZntR in Chromohalobacter salexigens DSM 3043

Properties
Regulator type:	Transcription factor
TF locus tag:	Csal_1304
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	ZntR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - ZntR
By TF family - MerR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5 Sequence: GACCTGGAGTGCACTCCAGGGT Locus tag: Csal_1006 Name: COG1230 Funciton: Co/Zn/Cd efflux system component
	Csal_1006	COG1230	Co/Zn/Cd efflux system component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD