Regulon of GntR in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_6141
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -145 Score: 5.8 Sequence: CAGGGATAGCGCTATCCCGC Position: -70 Score: 6.1 Sequence: CTGGGACAGCGCTATCCTAG Position: -54 Score: 5.7 Sequence: CTAGGACAGCGCTGTCCAAT Locus tag: Vapar_6141 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Vapar_6141	gntR	Gluconate utilization transcriptional regulator GntR, LacI family
Position: -157 Score: 5.7 Sequence: ATTGGACAGCGCTGTCCTAG Position: -141 Score: 6.1 Sequence: CTAGGATAGCGCTGTCCCAG Position: -66 Score: 5.8 Sequence: GCGGGATAGCGCTATCCCTG Locus tag: Vapar_6142 Name: gntT Funciton: High-affinity H+/gluconate symporter Locus tag: Vapar_6143 Name: gntK3 Funciton: Gluconokinase, Firmicutes type (EC 2.7.1.12)
	Vapar_6142	gntT	High-affinity H+/gluconate symporter
	Vapar_6143	gntK3	Gluconokinase, Firmicutes type (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD