Regulon of Zur in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_1336
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Clostridia-1
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5.5 Sequence: TAAATGCAAATACATTGCAACAA Locus tag: Cbei_3261 Name: CAC1592 Funciton: ABC transporter, permease protein
	Cbei_3261	CAC1592	ABC transporter, permease protein
Position: -34 Score: 5.1 Sequence: CAAATGCAAATCAGATGCAAACT Locus tag: Cbei_0477 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Cbei_0477	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -34 Score: 5.6 Sequence: CAAATGCAAATCGTATGCATGTG Locus tag: Cbei_4668 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Cbei_4668	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -60 Score: 6.4 Sequence: CTATTGCAAATTATTTGCATTTG Locus tag: Cbei_4334 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Cbei_4335 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Cbei_4334	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Cbei_4335	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -53 Score: 5.6 Sequence: TAATTGAGAATGATTTTCAAAAT Locus tag: Cbei_2410 Name: fld Funciton: Flavodoxin Locus tag: Cbei_2411 Name: CAC0588 Funciton: conserved hypothetical protein
	Cbei_2410	fld	Flavodoxin
	Cbei_2411	CAC0588	conserved hypothetical protein
Position: -168 Score: 5.4 Sequence: TCATTGAAAATCATTTTCAATGA Position: -112 Score: 5.4 Sequence: TTAATTAAAATCATTATCAATTG Locus tag: Cbei_4198 Name: feoA Funciton: ferrous iron transport protein A Locus tag: Cbei_4197 Name: feoA2 Funciton: Ferrous iron transport protein A Locus tag: Cbei_4196 Name: feoB Funciton: Ferrous iron transport protein B
	Cbei_4198	feoA	ferrous iron transport protein A
	Cbei_4197	feoA2	Ferrous iron transport protein A
	Cbei_4196	feoB	Ferrous iron transport protein B

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD