Regulon of FlpA in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type:	Transcription factor
TF locus tag:	L0239
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.8 Sequence: TTCTTGATGGCTATCAATTT Locus tag: L63697 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-) Locus tag: L0239 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	L63697	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
	L0239	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family
Position: -88 Score: 5.7 Sequence: TTCTTGATGTAAATCAATGT Locus tag: L134080 Name: copZ Funciton: Copper chaperone
	L134080	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD