Regulon of YtrA in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_0325, lp_1959
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	YtrA - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 6.3 Sequence: GTGTACTAGTTGTAGTAATACAC Locus tag: lp_1959 Name: ytrA Funciton: Predicted transcriptional regulator, GntR family Locus tag: lp_1958 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: lp_1957 Name: null Funciton: ABC transporter, permease protein Locus tag: lp_1956 Name: null Funciton: ABC transporter, permease protein
	lp_1959	ytrA	Predicted transcriptional regulator, GntR family
	lp_1958	ytrB	Predicted ABC transporter, ATP-binding protein
	lp_1957		ABC transporter, permease protein
	lp_1956		ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD