Regulon of NanR in Bacteroides eggerthii DSM 20697

Properties
Regulator type:	Transcription factor
TF locus tag:	BACEGG_02291
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Sialic acid utilization; N-acetylglucosamine utilization
Effector:	N-acetylglucosamine; N-acetylneuraminic acid
Regulog:	NanR - Bacteroidaceae
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 59 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - ROK
By effector - N-acetylglucosamine
By effector - N-acetylneuraminic acid
By pathway - Sialic acid utilization
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.2 Sequence: TAATTAATAAATTATTTTATTAT Locus tag: BACEGG_02291 Name: nanR Funciton: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
	BACEGG_02291	nanR	Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Position: -85 Score: 6 Sequence: TTAATAAAATAATTTATTAAATA Locus tag: BACEGG_02293 Name: nanT-II Funciton: Predicted N-acetyl-neuraminate transporter, MFS family Locus tag: BACEGG_02294 Name: nanA Funciton: N-acetylneuraminate lyase (EC 4.1.3.3) Locus tag: BACEGG_02295 Name: nanE-II Funciton: N-acetylmannosamine 2-epimerase Locus tag: BACEGG_02296 Name: susC_Nan-1 Funciton: TonB-dependent outer membrane transporter of sialic acid oligomers Locus tag: BACEGG_02297 Name: susD_Nan-1 Funciton: Outer membrane polysaccharide binding protein for sialic acid oligomers Locus tag: BACEGG_02298 Name: GH43 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
	BACEGG_02293	nanT-II	Predicted N-acetyl-neuraminate transporter, MFS family
	BACEGG_02294	nanA	N-acetylneuraminate lyase (EC 4.1.3.3)
	BACEGG_02295	nanE-II	N-acetylmannosamine 2-epimerase
	BACEGG_02296	susC_Nan-1	TonB-dependent outer membrane transporter of sialic acid oligomers
	BACEGG_02297	susD_Nan-1	Outer membrane polysaccharide binding protein for sialic acid oligomers
	BACEGG_02298	GH43	Glycosyl hydrolase family 43, five-bladed beta-propellor domain
Position: -94 Score: 6.2 Sequence: ATAATAAAATAATTTATTAATTA Locus tag: BACEGG_02292 Name: PF04074 Funciton: Conserved hypothetical protein, PF04074 family
	BACEGG_02292	PF04074	Conserved hypothetical protein, PF04074 family
Position: -44 Score: 5.5 Sequence: ATAATAAGTAATTTAATTAATTA Locus tag: BACEGG_00309 Name: exbB Funciton: Outer membrane transport system, transport protein ExbB Locus tag: BACEGG_00310 Name: null Funciton: hypothetical protein Locus tag: BACEGG_00311 Name: exbD Funciton: Outer membrane transport system, transport protein ExbD Locus tag: BACEGG_00312 Name: exbD2 Funciton: Outer membrane transport system, transport protein ExbD
	BACEGG_00309	exbB	Outer membrane transport system, transport protein ExbB
	BACEGG_00310		hypothetical protein
	BACEGG_00311	exbD	Outer membrane transport system, transport protein ExbD
	BACEGG_00312	exbD2	Outer membrane transport system, transport protein ExbD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD