Regulon of CtsR in Oenococcus oeni PSU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	OEOE_0513
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.5 Sequence: AAATGTTTGACCAATCTTGACTAT Locus tag: OEOE_1310 Name: grpE Funciton: Heat shock protein GrpE Locus tag: OEOE_1309 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: OEOE_1308 Name: dnaJ Funciton: Chaperone protein DnaJ
	OEOE_1310	grpE	Heat shock protein GrpE
	OEOE_1309	dnaK	Chaperone protein DnaK
	OEOE_1308	dnaJ	Chaperone protein DnaJ
Position: -21 Score: -0.9 Sequence: TTAGTCAGGAATGGTCAAATTATG Locus tag: OEOE_0513 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: OEOE_0514 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	OEOE_0513	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	OEOE_0514	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -27 Score: -1.3 Sequence: AAGGTCAATAAAGGTCAAACATTG Locus tag: OEOE_0640 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	OEOE_0640	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -96 Score: 6.5 Sequence: TTTTATTTGACCTTTCTTGACTTT Locus tag: OEOE_0289 Name: hsp Funciton: Small heat shock protein
	OEOE_0289	hsp	Small heat shock protein
Position: -63 Score: 6.7 Sequence: AAAAGTTTGACCTTTCTTGACCAT Locus tag: OEOE_0570 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	OEOE_0570	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -72 Score: 6.7 Sequence: AAAAGTTTGACCTTTTTTGACCAA Locus tag: OEOE_1397 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: OEOE_1396 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	OEOE_1397	groS	Heat shock protein 60 family co-chaperone GroES
	OEOE_1396	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD