Regulon of Zur in Mycobacterium smegmatis str. MC2 155

Properties
Regulator type:	Transcription factor
TF locus tag:	MSMEG_4487
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Mycobacteriaceae
Statistics of regulated genes:
- Genes	15
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 70 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 5.3 Sequence: TAACGATAACCGTTTGCATTA Position: -30 Score: 6.1 Sequence: TATTGAAAATCATTTTCGATA Locus tag: MSMEG_6048 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	MSMEG_6048	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -20 Score: 6 Sequence: TAATGAAAACGATTTCCAATT Locus tag: MSMEG_4486 Name: znr Funciton: Zinc homeostasis transcriptional regulator Znr, ArsR family Locus tag: MSMEG_4487 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	MSMEG_4486	znr	Zinc homeostasis transcriptional regulator Znr, ArsR family
	MSMEG_4487	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -55 Score: 6.3 Sequence: TATTGAAAACGATTGTCATTA Locus tag: MSMEG_6068 Name: rpmB1 Funciton: 50S ribosomal protein L28 Locus tag: MSMEG_6067 Name: rpmG1 Funciton: 50S ribosomal protein L33 Locus tag: MSMEG_6066 Name: rpsN2 Funciton: SSU ribosomal protein S14p Locus tag: MSMEG_6065 Name: rpsR1 Funciton: 30S ribosomal protein S18
	MSMEG_6068	rpmB1	50S ribosomal protein L28
	MSMEG_6067	rpmG1	50S ribosomal protein L33
	MSMEG_6066	rpsN2	SSU ribosomal protein S14p
	MSMEG_6065	rpsR1	30S ribosomal protein S18
Position: -54 Score: 6.3 Sequence: TAATGACAATCGTTTTCAATA Locus tag: MSMEG_6069 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: MSMEG_6070 Name: rpmE2 Funciton: 50S ribosomal protein L31
	MSMEG_6069	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	MSMEG_6070	rpmE2	50S ribosomal protein L31
Position: -90 Score: 6.1 Sequence: TATCGAAAATGATTTTCAATA Position: -44 Score: 5.3 Sequence: TAATGCAAACGGTTATCGTTA Locus tag: MSMEG_6047 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: MSMEG_6046 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MSMEG_6045 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	MSMEG_6047	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	MSMEG_6046	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	MSMEG_6045	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -31 Score: 5.9 Sequence: TAATGATAATCGTTTTCAAAA Locus tag: MSMEG_6052 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MSMEG_6053 Name: bluB Funciton: Cobalamin biosynthesis protein BluB @ 5,6-dimethylbenzimidazole synthase, flavin destructase family Locus tag: MSMEG_6054 Name: lamB Funciton: Conserved hypothetical protein (LamB/YcsF)
	MSMEG_6052	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	MSMEG_6053	bluB	Cobalamin biosynthesis protein BluB @ 5,6-dimethylbenzimidazole synthase, flavin destructase family
	MSMEG_6054	lamB	Conserved hypothetical protein (LamB/YcsF)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Mycobacterium smegmatis str. MC2 155

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --