Regulon of Fur in Shewanella loihica PV-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shew_1661
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Regulog:	Fur - Shewanellaceae
Statistics of regulated genes:
- Genes	34
- Operons	21
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 505 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - FUR
By TF family - FUR
By effector - Iron ion, (Fe2+)
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 6 Sequence: TAATGATAACTATTATCATTA Locus tag: Shew_1936 Name: null Funciton: Two component transcriptional regulator, Winged helix family
	Shew_1936		Two component transcriptional regulator, Winged helix family
Position: -136 Score: 5.9 Sequence: AAATGATAACCATTCCCATTT Locus tag: Shew_3097 Name: Sden_3064 Funciton: TonB-dependent receptor
	Shew_3097	Sden_3064	TonB-dependent receptor
Position: -108 Score: 5.6 Sequence: GAATGAAATTAATTCTCATTA Locus tag: Shew_1181 Name: piuB Funciton: Uncharacterized iron-regulated membrane protein, PiuB
	Shew_1181	piuB	Uncharacterized iron-regulated membrane protein, PiuB
Position: -83 Score: 5.3 Sequence: AAATGCAACCAATTCTCATTT Locus tag: Shew_3658 Name: null Funciton: Hypothetical outer membrane protein
	Shew_3658		Hypothetical outer membrane protein
Position: -115 Score: 4.8 Sequence: GAATGAGAACGATTTTCTTTG Locus tag: Shew_2873 Name: bfr2 Funciton: Bacterioferritin subunit 2 Locus tag: Shew_2872 Name: bfr1 Funciton: Bacterioferritin subunit 1
	Shew_2873	bfr2	Bacterioferritin subunit 2
	Shew_2872	bfr1	Bacterioferritin subunit 1
Position: -84 Score: 5.7 Sequence: TAATGATAATAGTTTGCATTA Locus tag: Shew_3120 Name: Sfri_4035 Funciton: Conserved hypothetical signal peptide protein, possibly porin Locus tag: Shew_3121 Name: null Funciton: FMN-binding domain-containing protein Locus tag: Shew_3122 Name: COG3182 Funciton: PepSY-associated TM helix domain-containing protein
	Shew_3120	Sfri_4035	Conserved hypothetical signal peptide protein, possibly porin
	Shew_3121		FMN-binding domain-containing protein
	Shew_3122	COG3182	PepSY-associated TM helix domain-containing protein
Position: -69 Score: 6 Sequence: AAATAAAAACAATTCTCATTT Locus tag: Shew_3841 Name: null Funciton: TonB-dependent siderophore receptor
	Shew_3841		TonB-dependent siderophore receptor
Position: -55 Score: 5.3 Sequence: TGTTGAGAATCATTCTCACTA Locus tag: Shew_2300 Name: null Funciton: Hypothetical inner membrane protein
	Shew_2300		Hypothetical inner membrane protein
Position: -46 Score: 6.5 Sequence: AAATGATAATAATTATCATTT Locus tag: Shew_3815 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shew_3815		Conserved hypothetical inner membrane protein
Position: -381 Score: 5.4 Sequence: TAACGATAATTATTTGCATTT Locus tag: Shew_0042 Name: ftn Funciton: Ferritin, Ftn
	Shew_0042	ftn	Ferritin, Ftn
Position: -77 Score: 6 Sequence: TAATGCAAATTATTCTCATTT Locus tag: Shew_0675 Name: Sfri_0810 Funciton: Hypothetical protein Locus tag: Shew_0676 Name: Sfri_0811 Funciton: Imelysin peptidase family lipoprotein Locus tag: Shew_0677 Name: Sfri_0812 Funciton: Protein of unknown function DUF1111
	Shew_0675	Sfri_0810	Hypothetical protein
	Shew_0676	Sfri_0811	Imelysin peptidase family lipoprotein
	Shew_0677	Sfri_0812	Protein of unknown function DUF1111
Position: -192 Score: 5.8 Sequence: CAATGAAAATGGTTCTCATTT Position: -123 Score: 5.7 Sequence: AATTGAAAATTATTATCGTTT Locus tag: Shew_2518 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: Shew_2517 Name: feoB Funciton: Ferrous iron transport protein B
	Shew_2518	feoA	Ferrous iron transport protein A
	Shew_2517	feoB	Ferrous iron transport protein B
Position: -41 Score: 6.1 Sequence: AATTGATAATTATTATCATTA Locus tag: Shew_0861 Name: fbpA Funciton: ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA Locus tag: Shew_0862 Name: fbpB Funciton: ABC iron(III) transporter, inner membrane subunit, FbpB Locus tag: Shew_0863 Name: fbpC Funciton: ABC iron(III) transporter, ATPase subunit, FbpC
	Shew_0861	fbpA	ABC iron(III) transporter, periplasmic ligand-binding subunit, FbpA
	Shew_0862	fbpB	ABC iron(III) transporter, inner membrane subunit, FbpB
	Shew_0863	fbpC	ABC iron(III) transporter, ATPase subunit, FbpC
Position: -57 Score: 5.4 Sequence: CAGTGAGAATCGTTTTCATTT Locus tag: Shew_0552 Name: bfd Funciton: Bacterioferritin-associated ferredoxin
	Shew_0552	bfd	Bacterioferritin-associated ferredoxin
Position: -291 Score: 5.7 Sequence: AAACGATAATAATTTTCAATT Position: -222 Score: 5.8 Sequence: AAATGAGAACCATTTTCATTG Locus tag: Shew_2519 Name: mtrD Funciton: Periplasmic decaheme cytochrome c, MtrD Locus tag: Shew_2520 Name: mtrE Funciton: Outer membrane protein, MtrE Locus tag: Shew_2521 Name: mtrF Funciton: Surface localized decaheme cytochrome c lipoprotein, MtrF Locus tag: Shew_2522 Name: omcA Funciton: Surface localized decaheme cytochrome c lipoprotein, OmcA
	Shew_2519	mtrD	Periplasmic decaheme cytochrome c, MtrD
	Shew_2520	mtrE	Outer membrane protein, MtrE
	Shew_2521	mtrF	Surface localized decaheme cytochrome c lipoprotein, MtrF
	Shew_2522	omcA	Surface localized decaheme cytochrome c lipoprotein, OmcA
Position: -72 Score: 4.9 Sequence: ATATGATAATCTATATCATTC Locus tag: Shew_1688 Name: SO4423.1 Funciton: TonB-dependent ferric achromobactin receptor
	Shew_1688	SO4423.1	TonB-dependent ferric achromobactin receptor
Position: -63 Score: 4.5 Sequence: GAATGAGAACCTATCTCAACA Locus tag: Shew_1240 Name: null Funciton: Conserved hypothetical protein Locus tag: Shew_1239 Name: null Funciton: Iron-regulated membrane protein Locus tag: Shew_1238 Name: null Funciton: Conserved hypothetical inner membrane protein
	Shew_1240		Conserved hypothetical protein
	Shew_1239		Iron-regulated membrane protein
	Shew_1238		Conserved hypothetical inner membrane protein
Position: -51 Score: 6 Sequence: TATTGATAATCGTTATCATTT Locus tag: Shew_2690 Name: null Funciton: TonB-dependent receptor
	Shew_2690		TonB-dependent receptor
Position: -136 Score: 5.9 Sequence: AAATGATAACCATTCCCATTT Locus tag: Shew_3097 Name: null Funciton: TonB-dependent siderophore receptor
	Shew_3097		TonB-dependent siderophore receptor
Position: -108 Score: 5.6 Sequence: GAATGAAATTAATTCTCATTA Locus tag: Shew_1181 Name: piuB Funciton: Iron-uptake factor PiuB
	Shew_1181	piuB	Iron-uptake factor PiuB
Position: -43 Score: 6.3 Sequence: AAATGATAATGATTATCAATT Locus tag: Shew_1146 Name: null Funciton: Hypothetical inner membrane protein
	Shew_1146		Hypothetical inner membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Fur in Shewanella loihica PV-4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --