Regulon of PaaR in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_3375
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Ralstonia
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -149 Score: 6.1 Sequence: ATTAACCGACCAGTCGGTCGGC Locus tag: Rmet_3162 Name: paaF2 Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	Rmet_3162	paaF2	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -113 Score: 6.8 Sequence: ATTGACCGACCGGTCGGTTTAT Locus tag: Rmet_3369 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: Rmet_3370 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: Rmet_3371 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: Rmet_3372 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: Rmet_3373 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: Rmet_3374 Name: paaW Funciton: Protein of unknown function DUF3658/DUF1835 Locus tag: Rmet_3375 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Rmet_3369	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	Rmet_3370	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	Rmet_3371	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	Rmet_3372	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	Rmet_3373	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	Rmet_3374	paaW	Protein of unknown function DUF3658/DUF1835
	Rmet_3375	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -100 Score: 5.8 Sequence: GCCGACCGACTGGTCGGTTAAT Locus tag: Rmet_3163 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Rmet_3164 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Rmet_3165 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	Rmet_3163	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	Rmet_3164	paaY	thioesterase superfamily protein
	Rmet_3165	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD