Regulon of PaaR in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_1g02350
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Burkholderia
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By trascription factor - PaaR
By taxonomy - Burkholderia
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.2 Sequence: GCCGACCAACCGGTCGGTTAAT Locus tag: bglu_1g04490 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: bglu_1g04480 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: bglu_1g04470 Name: paaY Funciton: thioesterase superfamily protein Locus tag: bglu_1g04460 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	bglu_1g04490	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	bglu_1g04480	paaF	Enoyl-CoA hydratase (EC 4.2.1.17)
	bglu_1g04470	paaY	thioesterase superfamily protein
	bglu_1g04460	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -87 Score: 6.5 Sequence: ATTAACCGACCGGTTGGTCGGC Locus tag: bglu_1g04500 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
	bglu_1g04500	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
Position: -62 Score: 6.8 Sequence: ATTAACCGACCGGACGGTTGGT Locus tag: bglu_1g02410 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: bglu_1g02400 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: bglu_1g02390 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: bglu_1g02380 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: bglu_1g02370 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: bglu_1g02360 Name: paaW Funciton: Protein of unknown function DUF3658/DUF1835 Locus tag: bglu_1g02350 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	bglu_1g02410	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	bglu_1g02400	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	bglu_1g02390	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	bglu_1g02380	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	bglu_1g02370	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	bglu_1g02360	paaW	Protein of unknown function DUF3658/DUF1835
	bglu_1g02350	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD