Regulon of MntR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type:	Transcription factor
TF locus tag:	Sez_1470
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Streptococcaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 6.2 Sequence: TTAATTAAGTATAGTTAATTAT Locus tag: Sez_1470 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	Sez_1470	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -51 Score: 6.4 Sequence: ATAATTAACTATACTTAATTAA Locus tag: Sez_1469 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: Sez_1468 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: Sez_1467 Name: mntC Funciton: Manganese ABC transporter, permease protein
	Sez_1469	mntA	Manganese ABC transporter, substrate-binding protein
	Sez_1468	mntB	Manganese ABC transporter, ATP-binding protein
	Sez_1467	mntC	Manganese ABC transporter, permease protein
Position: -79 Score: 5.9 Sequence: TAAATTAACCATACTTAATTTT Locus tag: Sez_1456 Name: nikA Funciton: Nickel ABC transporter, substrate-binding protein Locus tag: Sez_1455 Name: nikB Funciton: Nickel ABC transporter, permease protein 1 Locus tag: Sez_1454 Name: nikC Funciton: Nickel ABC transporter, permease protein 2 Locus tag: Sez_1453 Name: nikD Funciton: Nickel ABC transporter, ATP-binding protein 1 Locus tag: Sez_1452 Name: nikE Funciton: Nickel ABC transporter, ATP-binding protein 2
	Sez_1456	nikA	Nickel ABC transporter, substrate-binding protein
	Sez_1455	nikB	Nickel ABC transporter, permease protein 1
	Sez_1454	nikC	Nickel ABC transporter, permease protein 2
	Sez_1453	nikD	Nickel ABC transporter, ATP-binding protein 1
	Sez_1452	nikE	Nickel ABC transporter, ATP-binding protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD