Regulon of SPy1285 in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_1714
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Transport
Effector:
Regulog:	SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 31 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - GntR/Others
By pathway - Transport

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 6.5 Sequence: GTGTATTATATATCTAGTACAA Locus tag: SP_0785 Name: SPy0836 Funciton: Predicted ABC transporter, periplasmic protein Locus tag: SP_0786 Name: SPy0837 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: SP_0787 Name: SPy0838 Funciton: Predicted ABC transporter, permease protein
	SP_0785	SPy0836	Predicted ABC transporter, periplasmic protein
	SP_0786	SPy0837	Predicted ABC transporter, ATP-binding protein
	SP_0787	SPy0838	Predicted ABC transporter, permease protein
Position: -57 Score: 4.3 Sequence: TTGTATCAAAGTGCTAGTATAG Locus tag: SP_1381 Name: SAG0280 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: SP_1380 Name: SAG0281 Funciton: ABC transporter permease protein
	SP_1381	SAG0280	ABC-type multidrug transport system, ATPase component
	SP_1380	SAG0281	ABC transporter permease protein
Position: -46 Score: 6.7 Sequence: TTGTATTATTTAATTAAGACAA Locus tag: SP_1714 Name: SPy1285 Funciton: Predicted transcriptional regulator, GntR family Locus tag: SP_1715 Name: SPy1287 Funciton: Predicted ABC transporter, ATP-binding protein 2
	SP_1714	SPy1285	Predicted transcriptional regulator, GntR family
	SP_1715	SPy1287	Predicted ABC transporter, ATP-binding protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD