Regulon of XylR in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mlr3714
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Rhizobiales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 5.9 Sequence: ATTTTTTCGAGACCCGAAAAAAA Locus tag: mlr5033 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	mlr5033	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -209 Score: 5.6 Sequence: ATTTTTTCGAGCCTCGAAAAAAC Position: -125 Score: 6 Sequence: TTTTTTTCGAGCCTCGGAATAAA Locus tag: mlr3714 Name: xylR Funciton: Xylose repressor XylR, ROK family
	mlr3714	xylR	Xylose repressor XylR, ROK family
Position: -171 Score: 6 Sequence: TTTATTCCGAGGCTCGAAAAAAA Position: -87 Score: 5.6 Sequence: GTTTTTTCGAGGCTCGAAAAAAT Locus tag: mll3713 Name: xylF Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF Locus tag: mll3711 Name: xylH Funciton: Xylose ABC transporter, permease protein XylH Locus tag: mll3710 Name: xylG Funciton: Xylose ABC transporter, ATP-binding protein XylG
	mll3713	xylF	Xylose ABC transporter, periplasmic xylose-binding protein XylF
	mll3711	xylH	Xylose ABC transporter, permease protein XylH
	mll3710	xylG	Xylose ABC transporter, ATP-binding protein XylG

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD