Regulon of ModE2 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_2331, Desal_2665
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Regulog:	ModE2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	17
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 48 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdenum
By pathway - Molybdopterin biosynthesis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -336 Score: 5.2 Sequence: ATTATGTCATTTTGGACCTAAT Position: -114 Score: 5.2 Sequence: ATTATGTCTTTTTTGATATATC Locus tag: Desal_0300 Name: null Funciton: molybdopterin binding domain protein Locus tag: Desal_0299 Name: null Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
	Desal_0300		molybdopterin binding domain protein
	Desal_0299		aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Position: -143 Score: 4.8 Sequence: TCTATGTCAATATGAGCACAAT Locus tag: Desal_2877 Name: null Funciton: formate dehydrogenase family accessory protein FdhD
	Desal_2877		formate dehydrogenase family accessory protein FdhD
Position: -106 Score: 5 Sequence: ATTATGCTCTCCATGACATATG Locus tag: Desal_2416 Name: wtpA Funciton: ABC-type tungstate/molybdate transport system, periplasmic component Locus tag: Desal_2417 Name: wtpB Funciton: ABC-type tungstate/molybdate transport system, permease protein Locus tag: Desal_2418 Name: wtpC Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
	Desal_2416	wtpA	ABC-type tungstate/molybdate transport system, periplasmic component
	Desal_2417	wtpB	ABC-type tungstate/molybdate transport system, permease protein
	Desal_2418	wtpC	ABC-type tungstate/molybdate transport system, ATP-binding component
Position: -178 Score: 4.9 Sequence: ATTATACCATTTTAGCCATAAT Position: -78 Score: 4.1 Sequence: CATATGCTTTTTTTAACAGGAA Locus tag: Desal_2878 Name: null Funciton: formate dehydrogenase formation protein FdhE Locus tag: Desal_2879 Name: null Funciton: Molybdenum cofactor biosynthesis protein MoaA
	Desal_2878		formate dehydrogenase formation protein FdhE
	Desal_2879		Molybdenum cofactor biosynthesis protein MoaA
Position: -48 Score: 5.1 Sequence: ATTGTGCCCTATACGGCATAAT Locus tag: Desal_2666 Name: null Funciton: Formylmethanofuran dehydrogenase subunit E Locus tag: Desal_2665 Name: null Funciton: Transcriptional regulator, ModE family
	Desal_2666		Formylmethanofuran dehydrogenase subunit E
	Desal_2665		Transcriptional regulator, ModE family
Position: -169 Score: 5.3 Sequence: AATATGCCAAAAAAGATATAAT Locus tag: Desal_1641 Name: null Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
	Desal_1641		Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
Position: -127 Score: 5 Sequence: TATGTGCTAAATCTAACATATT Locus tag: Desal_2659 Name: null Funciton: formate dehydrogenase, alpha subunit Locus tag: Desal_2658 Name: null Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2) Locus tag: Desal_2657 Name: null Funciton: formate dehydrogenase formation protein FdhE, putative
	Desal_2659		formate dehydrogenase, alpha subunit
	Desal_2658		Formate dehydrogenase O beta subunit (EC 1.2.1.2)
	Desal_2657		formate dehydrogenase formation protein FdhE, putative
Position: -245 Score: 4.1 Sequence: GATATATTTTAAACAGCATAGG Position: -136 Score: 4.8 Sequence: ATTGTGCTCATATTGACATAGA Locus tag: Desal_2876 Name: null Funciton: ABC-type tungstate transport system, periplasmic binding protein Locus tag: Desal_2875 Name: null Funciton: ABC-type tungstate transport system, permease protein Locus tag: Desal_2874 Name: null Funciton: ABC-type tungstate transport system, ATP-binding protein
	Desal_2876		ABC-type tungstate transport system, periplasmic binding protein
	Desal_2875		ABC-type tungstate transport system, permease protein
	Desal_2874		ABC-type tungstate transport system, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of ModE2 in Desulfovibrio salexigens DSM 2638

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --