Regulon of LexA in Vibrio parahaemolyticus RIMD 2210633

Properties
Regulator type:	Transcription factor
TF locus tag:	VP2945
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Vibrionales
Statistics of regulated genes:
- Genes	22
- Operons	18
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 186 sites [see more]

Member of regulog collections

By trascription factor - LexA
By taxonomy - Vibrionales
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.4 Sequence: TACTGGATATACTCACAGTT Position: -25 Score: 5.6 Sequence: AACTGTATAAAAAGACAGGT Locus tag: VP2945 Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
	VP2945	lexA	SOS-response repressor and protease LexA (EC 3.4.21.88)
Position: -31 Score: 5.6 Sequence: TACTGTATTTTTAACCAGTG Locus tag: VP2342 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	VP2342	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -110 Score: 5.4 Sequence: CACTGTATGAATCAACAGTA Locus tag: VP2550 Name: recA Funciton: Recombinase A Locus tag: VP2549 Name: recX Funciton: Regulatory protein RecX
	VP2550	recA	Recombinase A
	VP2549	recX	Regulatory protein RecX
Position: -68 Score: 6 Sequence: TACTGTATAAAGAAACAGTA Position: -46 Score: 5.4 Sequence: TACTGTTCTCATATACAGTA Locus tag: VP0648 Name: recN Funciton: DNA repair protein RecN
	VP0648	recN	DNA repair protein RecN
Position: -85 Score: 5.7 Sequence: TACTGTTCATTTATACAGTT Locus tag: VP2149 Name: topB Funciton: DNA topoisomerase III (EC 5.99.1.2)
	VP2149	topB	DNA topoisomerase III (EC 5.99.1.2)
Position: -39 Score: 5.6 Sequence: TACTGTATACACATACAGCA Locus tag: VP1264 Name: VC1191 Funciton: Superfamily II DNA and RNA helicase
	VP1264	VC1191	Superfamily II DNA and RNA helicase
Position: -74 Score: 5 Sequence: AGGTGTATATATATACAGCG Locus tag: VP2100 Name: uvrB Funciton: Excinuclease ABC subunit B
	VP2100	uvrB	Excinuclease ABC subunit B
Position: -30 Score: 5.1 Sequence: ACCTGTATAAATAAACAGAC Locus tag: VP1865 Name: intIA Funciton: Integron integrase IntI4
	VP1865	intIA	Integron integrase IntI4
Position: -29 Score: 5.9 Sequence: TACTGTATTTATATACAGGT Locus tag: VP2034 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: VP2035 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: VP2036 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
	VP2034	imuA	Predicted RecA/RadA recombinase
	VP2035	imuB	DNA polymerase-like protein PA0670
	VP2036	dnaE2	DNA polymerase III alpha subunit (EC 2.7.7.7)
Position: -39 Score: 6 Sequence: TACTGTTTTTATATACAGTA Locus tag: VP1428 Name: VC1368 Funciton: Conserved hypothetical protein
	VP1428	VC1368	Conserved hypothetical protein
Position: -65 Score: 5 Sequence: TCCTGTACAAAAACACAGCT Locus tag: VP0157 Name: recG Funciton: ATP-dependent DNA helicase RecG (EC 3.6.1.-)
	VP0157	recG	ATP-dependent DNA helicase RecG (EC 3.6.1.-)
Position: -162 Score: 4.6 Sequence: CCCTGTTTATTCATCCAGCC Locus tag: VP0518 Name: mutH Funciton: DNA mismatch repair endonuclease MutH
	VP0518	mutH	DNA mismatch repair endonuclease MutH
Position: -67 Score: 5.5 Sequence: AACTGGACATTTATCCAGTG Locus tag: VP0094 Name: rmuC Funciton: DNA recombination protein RmuC
	VP0094	rmuC	DNA recombination protein RmuC
Position: -63 Score: 5.1 Sequence: GACTGGATGTCTATCCAGTT Locus tag: VP1051 Name: ruvA Funciton: Holliday junction DNA helicase RuvA Locus tag: VP1052 Name: ruvB Funciton: Holliday junction DNA helicase RuvB
	VP1051	ruvA	Holliday junction DNA helicase RuvA
	VP1052	ruvB	Holliday junction DNA helicase RuvB
Position: -85 Score: 5.3 Sequence: TACTGTTTTTTTGTCCAGTA Locus tag: VP2712 Name: uvrA Funciton: Excinuclease ABC subunit A
	VP2712	uvrA	Excinuclease ABC subunit A
Position: -27 Score: 5.4 Sequence: TTATGTATAAATAACCAGTA Locus tag: VP3013 Name: uvrD Funciton: ATP-dependent DNA helicase II
	VP3013	uvrD	ATP-dependent DNA helicase II
Position: -47 Score: 5.8 Sequence: AACTGTATAAAAAGCCAGTA Locus tag: VP2379 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	VP2379	yebG	SOS regulon DNA damage-inducible protein
Position: -41 Score: 5.2 Sequence: ACCTGTCTTTTTATACAGTT Position: -21 Score: 5.2 Sequence: AACTGTGAGTATATCCAGTA Locus tag: VP2946 Name: VP2946 Funciton: Hypothetical protein
	VP2946	VP2946	Hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Vibrio parahaemolyticus RIMD 2210633

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --