Regulon of Irr in Azorhizobium caulinodans ORS 571

Properties
Regulator type:	Transcription factor
TF locus tag:	AZC_3445, AZC_0367
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Regulog:	Irr - Rhizobiales
Statistics of regulated genes:
- Genes	25
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 122 sites [see more]

Member of regulog collections

By trascription factor - Irr
By taxonomy - Rhizobiales
By TF family - FUR
By effector - Heme
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 5.3 Sequence: AGTTTGGAATTGGTCTAATTA Locus tag: AZC_2246 Name: bfr Funciton: Bacterioferritin
	AZC_2246	bfr	Bacterioferritin
Position: -99 Score: 6 Sequence: TATTTAGAATAATTCTAATGT Locus tag: AZC_3616 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: AZC_3615 Name: sufB Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: AZC_3614 Name: sufC Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein Locus tag: AZC_3613 Name: sufD Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein Locus tag: AZC_3612 Name: sufS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily Locus tag: AZC_3611 Name: PF01883 Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly Locus tag: AZC_3610 Name: PF00903 Funciton: putative lactoylglutathione lyase Locus tag: AZC_3609 Name: sufA Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
	AZC_3616	sufS2	Cysteine desulfurase (EC 2.8.1.7)
	AZC_3615	sufB	ABC transporter involved in Fe-S cluster assembly, permease protein
	AZC_3614	sufC	ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
	AZC_3613	sufD	ABC transporter involved in Fe-S cluster assembly, permease protein
	AZC_3612	sufS1	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
	AZC_3611	PF01883	PaaD-like protein (DUF59) involved in Fe-S cluster assembly
	AZC_3610	PF00903	putative lactoylglutathione lyase
	AZC_3609	sufA	Iron binding protein SufA for iron-sulfur cluster assembly
Position: -36 Score: 5.6 Sequence: AAATTAGAAGAGTTCTAAAAA Locus tag: AZC_4085 Name: mbfA Funciton: membrane-bound ferritin
	AZC_4085	mbfA	membrane-bound ferritin
Position: -155 Score: 5.1 Sequence: TGTTTGGAATAAATCGAAAAA Locus tag: AZC_0183 Name: cbrA Funciton: iron siderophore ABC transporter, ATPase protein Locus tag: AZC_0184 Name: cbrB Funciton: iron siderophore ABC transporter, permease protein Locus tag: AZC_0185 Name: cbrC Funciton: iron siderophore ABC transporter, permease protein Locus tag: AZC_0186 Name: cbrD Funciton: iron siderophore ABC transporter, substrate bindiing protein
	AZC_0183	cbrA	iron siderophore ABC transporter, ATPase protein
	AZC_0184	cbrB	iron siderophore ABC transporter, permease protein
	AZC_0185	cbrC	iron siderophore ABC transporter, permease protein
	AZC_0186	cbrD	iron siderophore ABC transporter, substrate bindiing protein
Position: -65 Score: 3.7 Sequence: CAAGTTGATTACCTCTAAACT Locus tag: AZC_4385 Name: hmuT Funciton: Hemin ABC transporter, hemin-binding protein Locus tag: AZC_4386 Name: hmuU Funciton: Hemin ABC transporter, permease protein Locus tag: AZC_4387 Name: hmuV Funciton: Hemin ABC transporter, ATPase component
	AZC_4385	hmuT	Hemin ABC transporter, hemin-binding protein
	AZC_4386	hmuU	Hemin ABC transporter, permease protein
	AZC_4387	hmuV	Hemin ABC transporter, ATPase component
Position: -38 Score: 5.2 Sequence: AGTCTGGACCGGTTCTAAACA Locus tag: AZC_4058 Name: PF00033 Funciton: cytochrome b561
	AZC_4058	PF00033	cytochrome b561
Position: -53 Score: 5.3 Sequence: AGATTTGAATACTTCTGAACT Locus tag: AZC_1626 Name: fhuA Funciton: Ferric hydroxamate outer membrane receptor FhuA Locus tag: AZC_1625 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC Locus tag: AZC_1624 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: AZC_1623 Name: fhuB Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB Locus tag: AZC_1622 Name: PF08021 Funciton: iron-chelator utilization protein
	AZC_1626	fhuA	Ferric hydroxamate outer membrane receptor FhuA
	AZC_1625	fhuC	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
	AZC_1624	fhuD	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
	AZC_1623	fhuB	Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
	AZC_1622	PF08021	iron-chelator utilization protein
Position: -82 Score: 3.9 Sequence: ACACTGAAACAGTTATAAATA Locus tag: AZC_1632 Name: hmuR Funciton: TonB-dependent haem/haemoglobin receptor
	AZC_1632	hmuR	TonB-dependent haem/haemoglobin receptor
Position: -77 Score: 5 Sequence: AATATTGAATCGCTCTAAAGT Position: -17 Score: 5 Sequence: AGTTTGGAGTCATTCAAATGA Locus tag: AZC_1578 Name: hmuP Funciton: Hemin ABC transporter, hemin uptake protein
	AZC_1578	hmuP	Hemin ABC transporter, hemin uptake protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Irr in Azorhizobium caulinodans ORS 571

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --