Regulon of IscR in Methylobacillus flagellatus KT

Properties
Regulator type:	Transcription factor
TF locus tag:	Mfla_0810
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 4.6 Sequence: ATTTCAGAGTAAAATAGTCGGATGT Locus tag: Mfla_0811 Name: cysE Funciton: Serine acetyltransferase (EC 2.3.1.30)
	Mfla_0811	cysE	Serine acetyltransferase (EC 2.3.1.30)
Position: -111 Score: 6.3 Sequence: ATAGTTGACTAAAGTATTCAGGTAT Locus tag: Mfla_0810 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Mfla_0809 Name: iscS1 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Mfla_0808 Name: iscS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Mfla_0807 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Mfla_0806 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Mfla_0805 Name: hscB Funciton: Chaperone protein HscB Locus tag: Mfla_0804 Name: hscA Funciton: Chaperone protein HscA Locus tag: Mfla_0803 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Mfla_0810	iscR	Iron-sulfur cluster regulator IscR
	Mfla_0809	iscS1	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Mfla_0808	iscS2	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Mfla_0807	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Mfla_0806	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Mfla_0805	hscB	Chaperone protein HscB
	Mfla_0804	hscA	Chaperone protein HscA
	Mfla_0803	fdx	ferredoxin, 2Fe-2S type, ISC system

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD