Regulon of IscR in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_1237
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Alteromonadales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6.5 Sequence: ATACTTGACTAAAACAGTAGGATAA Position: -62 Score: 7 Sequence: ATACTTGACTAAAATAGTCGGGTTT Locus tag: Patl_1237 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Patl_1238 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Patl_1239 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Patl_1240 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Patl_1241 Name: hscB Funciton: Chaperone protein HscB Locus tag: Patl_1242 Name: hscA Funciton: Chaperone protein HscA Locus tag: Patl_1243 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	Patl_1237	iscR	Iron-sulfur cluster regulator IscR
	Patl_1238	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Patl_1239	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Patl_1240	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Patl_1241	hscB	Chaperone protein HscB
	Patl_1242	hscA	Chaperone protein HscA
	Patl_1243	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -118 Score: 6.2 Sequence: ATAGTTGATAAGATTAGTCAGGTAT Locus tag: Patl_0544 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Patl_0544	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -68 Score: 6.1 Sequence: TTACTTGAGTGTTTTAGTCAAGTAA Locus tag: Patl_4233 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Patl_4233	nfuA	NfuA Fe-S protein maturation

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD