Regulon of Zur in Phenylobacterium zucineum HLK1

Properties
Regulator type:	Transcription factor
TF locus tag:	PHZ_c0822
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Caulobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -19 Score: 6.2 Sequence: GTTATGTTATTTCATAACAGTGA Locus tag: PHZ_c0823 Name: znuL Funciton: Zinc-regulated TonB-dependent outer membrane transporter
	PHZ_c0823	znuL	Zinc-regulated TonB-dependent outer membrane transporter
Position: -75 Score: 5.8 Sequence: CATGTGTTACTTTATAACATCCC Locus tag: PHZ_c3369 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	PHZ_c3369	yciC	Putative zinc chaperone, COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD