Regulon of Zur in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_019410
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodospirillales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 27 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6 Sequence: TGTACGTTATGATATAACATTAC Locus tag: AZL_004800 Name: PF08856 Funciton: Hypothetical protein Locus tag: AZL_004790 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: AZL_004780 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: AZL_004770 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	AZL_004800	PF08856	Hypothetical protein
	AZL_004790	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	AZL_004780	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	AZL_004770	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -129 Score: 5.3 Sequence: GTCACGTTATAACGTAACATGTC Locus tag: AZL_d00760 Name: znuC3 Funciton: ABC-type Mn/Zn transport systems, ATPase component Locus tag: AZL_d00750 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	AZL_d00760	znuC3	ABC-type Mn/Zn transport systems, ATPase component
	AZL_d00750	znuB3	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -94 Score: 5.9 Sequence: GACATGTTACGTTATAACGTGAC Locus tag: AZL_d00770 Name: znuA3 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	AZL_d00770	znuA3	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD