Regulon of Zur in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL3175
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhizobiales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 42 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5.3 Sequence: GCGATGTGATCTTATAACATTAT Locus tag: RL4148 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: RL4149 Name: PF00400 Funciton: Conserved hypothetical protein
	RL4148	yciC	Putative zinc chaperone, COG0523 family
	RL4149	PF00400	Conserved hypothetical protein
Position: -158 Score: 5.4 Sequence: TAACCGTAATGTTATTACATTGT Locus tag: RL1047 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RL1048 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RL1049 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	RL1047	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	RL1048	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	RL1049	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -89 Score: 5.7 Sequence: TTGATGTAATAACATAACAATTG Locus tag: RL3178 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	RL3178	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -44 Score: 6.2 Sequence: CAAATGTAATGATATAACATAAA Locus tag: RL3179 Name: yciC2 Funciton: Putative Putative zinc chaperone, COG0523 family
	RL3179	yciC2	Putative Putative zinc chaperone, COG0523 family
Position: -81 Score: 5.8 Sequence: CAATTGTTATGTTATTACATCAA Locus tag: RL3177 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RL3176 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RL3175 Name: zur Funciton: Zinc uptake regulation protein Zur
	RL3177	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	RL3176	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	RL3175	zur	Zinc uptake regulation protein Zur

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD