Regulon of Zur in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_07527
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -239 Score: 5.6 Sequence: AAAATGTATTGTTATAACATAAC Position: -199 Score: 5.2 Sequence: CTATTGTTATGTTATAACATTCG Locus tag: PE36_02894 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
	PE36_02894	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
Position: -39 Score: 6.8 Sequence: TAATTGTTATGTTATAACATAAC Locus tag: PE36_11622 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
	PE36_11622	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
Position: -91 Score: 5.9 Sequence: GAATTGTTATAATATAACAATTC Position: -52 Score: 5.1 Sequence: CGACTGTTATGTTATATTATAAC Locus tag: PE36_16004 Name: zip Funciton: Predicted zinc transporter, ZIP family
	PE36_16004	zip	Predicted zinc transporter, ZIP family
Position: -37 Score: 6.9 Sequence: TGGGTGTTATGTTATAACATAAC Locus tag: PE36_07292 Name: rpmE Funciton: LSU ribosomal protein L31p Locus tag: PE36_07287 Name: rpmJ Funciton: 50S ribosomal protein L36
	PE36_07292	rpmE	LSU ribosomal protein L31p
	PE36_07287	rpmJ	50S ribosomal protein L36
Position: -66 Score: 6.8 Sequence: TAAATGTTATGTTATAACATAAC Locus tag: PE36_23371 Name: yciC Funciton: cobalamin synthesis protein/P47K family protein
	PE36_23371	yciC	cobalamin synthesis protein/P47K family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD