Regulon of Zur in Psychromonas sp. CNPT3

Properties
Regulator type:	Transcription factor
TF locus tag:	PCNPT3_12907
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5 Sequence: TTTTTGTTATATTATAACACTTT Locus tag: PCNPT3_01665 Name: zip Funciton: Predicted zinc transporter, ZIP family
	PCNPT3_01665	zip	Predicted zinc transporter, ZIP family
Position: -37 Score: 7.1 Sequence: TAAGTGTTATGTTATAACATAAC Locus tag: PCNPT3_03847 Name: rpmE Funciton: LSU ribosomal protein L31p Locus tag: PCNPT3_03852 Name: rpmJ Funciton: 50S ribosomal protein L36
	PCNPT3_03847	rpmE	LSU ribosomal protein L31p
	PCNPT3_03852	rpmJ	50S ribosomal protein L36

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD