Regulon of Zur in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_07999
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.8 Sequence: CTTTTGATATATTATCACATAAC Locus tag: PTD2_00701 Name: PF08856 Funciton: hypothetical protein
	PTD2_00701	PF08856	hypothetical protein
Position: -34 Score: 5.7 Sequence: GTTATGATATACTATCACATAAT Locus tag: PTD2_02796 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: PTD2_02801 Name: rpmJ Funciton: LSU ribosomal protein L36p
	PTD2_02796	rpmE2	LSU ribosomal protein L31p
	PTD2_02801	rpmJ	LSU ribosomal protein L36p
Position: -83 Score: 5.6 Sequence: CAAATGTTATAGCATCACAGTTG Position: -43 Score: 5 Sequence: GTAATGTTACACTATCTCAATTG Locus tag: PTD2_19912 Name: omr Funciton: Zinc-regulated outer membrane receptor
	PTD2_19912	omr	Zinc-regulated outer membrane receptor
Position: -47 Score: 6 Sequence: CTTTTGTTATATTATCACAATAT Locus tag: PTD2_14447 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25) Locus tag: PTD2_14452 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	PTD2_14447	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
	PTD2_14452	ribA	GTP cyclohydrolase II (EC 3.5.4.25)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD