Regulon of Zur in Vibrio salmonicida LFI1238

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAL_I0387
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	11
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 6.7 Sequence: GTTATGTTATAACATAACAATTA Locus tag: VSAL_I0890 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: VSAL_I0889 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	VSAL_I0890	rpmE2	LSU ribosomal protein L31p
	VSAL_I0889	rpmJ2	LSU ribosomal protein L36p
Position: -48 Score: 6.4 Sequence: AAAATGTTATATTATTACATTTA Locus tag: VSAL_I0429 Name: VC2551 Funciton: hypothetical protein Locus tag: VSAL_I0428 Name: zbp Funciton: Predicted zinc-binding protein
	VSAL_I0429	VC2551	hypothetical protein
	VSAL_I0428	zbp	Predicted zinc-binding protein
Position: -61 Score: 6.5 Sequence: TAAGTGTTATAATGTAACATTTT Locus tag: VSAL_I0852 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VSAL_I0852	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -50 Score: 6.6 Sequence: AAAATGTTACATTATAACACTTA Locus tag: VSAL_I0851 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VSAL_I0850 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VSAL_I0851	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VSAL_I0850	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -390 Score: 6.4 Sequence: AAAATGTTATATTATTACATTTA Locus tag: VSAL_I0428 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VSAL_I0427 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VSAL_I0426 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VSAL_I0425 Name: VC2555 Funciton: FIG003461: hypothetical protein
	VSAL_I0428	zbp	Predicted zinc-binding protein
	VSAL_I0427	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	VSAL_I0426	VC2554	ABC-type antimicrobial peptide transport system, permease component
	VSAL_I0425	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD