Regulon of NadQ in Psychrobacter arcticum 273-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Psyc_0633
Regulator family:	NadQ
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:
Regulog:	NadQ - Moraxellaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - NadQ
By TF family - NadQ
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 6.8 Sequence: TTATGCTCAAAATGAGCATAA Locus tag: Psyc_0632 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: Psyc_0631 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16)
	Psyc_0632	nadA	Quinolinate synthetase (EC 4.1.99.-)
	Psyc_0631	nadB	L-aspartate oxidase (EC 1.4.3.16)
Position: -186 Score: 6.8 Sequence: TTATGCTCATTTTGAGCATAA Locus tag: Psyc_0633 Name: nadQ Funciton: Transcriptional regulator of NAD metabolism, COG4111 family
	Psyc_0633	nadQ	Transcriptional regulator of NAD metabolism, COG4111 family
Position: -83 Score: 6.2 Sequence: TTATGCTCATTTTGAGTTTAA Locus tag: Psyc_0634 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	Psyc_0634	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD