Regulon of PirR in Synechocystis sp. PCC 6803

Properties
Regulator type:	Transcription factor
TF locus tag:	slr1871
Regulator family:	LysR
Regulation mode:	repressor
Biological process:	Salt stress response
Effector:
Regulog:	PirR - Cyanobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By TF family - LysR
By pathway - Salt stress response

Regulated operons
	Locus Tag	Name	Function
Position: -118 Score: 5.3 Sequence: TTGTCCCTATTTTGGATGCAA Position: -77 Score: 5 Sequence: TTGTCTTTATTGGGGATGCAA Locus tag: sll1773 Name: pirA Funciton: Pirin-like protein
	sll1773	pirA	Pirin-like protein
Position: -73 Score: 5 Sequence: TTGCATCCCCAATAAAGACAA Position: -32 Score: 5.3 Sequence: TTGCATCCAAAATAGGGACAA Locus tag: slr1871 Name: pirR Funciton: Salt stress response transcriptional regulator, LysR family
	slr1871	pirR	Salt stress response transcriptional regulator, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD