Regulon of ArsR2 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_2202
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:
Regulog:	ArsR2 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 5.7 Sequence: ATTTGGTTAATTTGCCAAAT Position: -34 Score: 5.4 Sequence: AATTTGCCAAATATAAACAT Locus tag: Desal_2205 Name: null Funciton: redox-active disulfide protein 2 Locus tag: Desal_2204 Name: trxA Funciton: Thioredoxin domain-containing protein Locus tag: Desal_2203 Name: null Funciton: thiol:disulfide interchange protein Locus tag: Desal_2202 Name: arsR2 Funciton: transcriptional regulator, ArsR family
	Desal_2205		redox-active disulfide protein 2
	Desal_2204	trxA	Thioredoxin domain-containing protein
	Desal_2203		thiol:disulfide interchange protein
	Desal_2202	arsR2	transcriptional regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD