Regulon of LexA in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y0572
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Enterobacteriales
Statistics of regulated genes:
- Genes	17
- Operons	15
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 265 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 4.7 Sequence: CCCTGTGTAAATCTACAGTG Locus tag: y0389 Name: uvrD Funciton: ATP-dependent DNA helicase II
	y0389	uvrD	ATP-dependent DNA helicase II
Position: -102 Score: 5.6 Sequence: TACTGTATGATTGTACAGTA Locus tag: y0881 Name: recA Funciton: Recombinase A Locus tag: y0882 Name: recX Funciton: regulatory protein RecX
	y0881	recA	Recombinase A
	y0882	recX	regulatory protein RecX
Position: -39 Score: 6.1 Sequence: TACTGTATATACATACAGCA Locus tag: y2734 Name: sulA Funciton: Cell division inhibitor sulA
	y2734	sulA	Cell division inhibitor sulA
Position: -41 Score: 5.3 Sequence: GACTGTATACTTATACAGCT Locus tag: y0959 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	y0959	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -47 Score: 5 Sequence: AGCTGTATATACTCACAGCA Position: -26 Score: 5.4 Sequence: AACTGTATAAACAAACAGGG Locus tag: y0572 Name: lexA Funciton: LexA repressor
	y0572	lexA	LexA repressor
Position: -86 Score: 5.7 Sequence: TCCTGTTTATTCATACAGTT Locus tag: y2800 Name: ftsK Funciton: DNA translocase FtsK
	y2800	ftsK	DNA translocase FtsK
Position: -39 Score: 5 Sequence: TACTGGATAAATCAACAGCT Locus tag: y1879 Name: ydjM Funciton: membrane-bound metal-dependent hydrolase
	y1879	ydjM	membrane-bound metal-dependent hydrolase
Position: 39 Score: 5.5 Sequence: TACTGTATATAAAACCAGTC Position: 61 Score: 4.5 Sequence: TACTGTGTTCAAATACAGAC Locus tag: y3075 Name: recN Funciton: DNA repair protein RecN
	y3075	recN	DNA repair protein RecN
Position: -97 Score: 5.3 Sequence: AGCTGGTTTTATATCCAGTA Locus tag: y3026 Name: uvrB Funciton: Excinuclease ABC subunit B
	y3026	uvrB	Excinuclease ABC subunit B
Position: -41 Score: 6.1 Sequence: TACTGTATAAATAAACAGTA Locus tag: y1747 Name: dinI Funciton: DNA damage-inducible protein
	y1747	dinI	DNA damage-inducible protein
Position: -244 Score: 4.4 Sequence: GGCTGGATATCCATCCAGCC Locus tag: y2253 Name: ruvA Funciton: Holliday junction helicase subunit A Locus tag: y2252 Name: ruvB Funciton: Holliday junction DNA helicase B
	y2253	ruvA	Holliday junction helicase subunit A
	y2252	ruvB	Holliday junction DNA helicase B
Position: -47 Score: 5.2 Sequence: CACTGTGATTATATACAGTT Locus tag: y2530 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	y2530	yebG	SOS regulon DNA damage-inducible protein
Position: -158 Score: 4.8 Sequence: ACCTGAATGGATATCCAGTG Locus tag: y0582 Name: ssb Funciton: single-strand binding protein
	y0582	ssb	single-strand binding protein
Position: -318 Score: 4.8 Sequence: CACTGGATATCCATTCAGGT Locus tag: y0580 Name: uvrA Funciton: excinuclease ABC subunit A
	y0580	uvrA	excinuclease ABC subunit A
Position: -62 Score: 4.6 Sequence: CTCTGGACATCCATACAGTA Locus tag: y0448 Name: rmuC Funciton: DNA recombination protein RmuC
	y0448	rmuC	DNA recombination protein RmuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Yersinia pestis KIM

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --