Regulon of Zur in Synechococcus elongatus PCC 7942

Properties
Regulator type:	Transcription factor
TF locus tag:	SYNPCC7942_0817
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Cyanobacteria
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 84 sites [see more]

Member of regulog collections

By taxonomy - Cyanobacteria
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 4.9 Sequence: TAGGGAATGATAACGATTCTCAA Locus tag: Synpcc7942_1316 Name: cce_1484 Funciton: Predicted Mn/Zn chelate ABC transporter, substrate-binding protein Locus tag: Synpcc7942_1317 Name: cce_1485 Funciton: Predicted Mn/Zn chelate ABC transporter, ATP-binding protein Locus tag: Synpcc7942_1318 Name: cce_1486 Funciton: Predicted Mn/Zn chelate ABC transporter, permease protein
	Synpcc7942_1316	cce_1484	Predicted Mn/Zn chelate ABC transporter, substrate-binding protein
	Synpcc7942_1317	cce_1485	Predicted Mn/Zn chelate ABC transporter, ATP-binding protein
	Synpcc7942_1318	cce_1486	Predicted Mn/Zn chelate ABC transporter, permease protein
Position: -37 Score: 6.1 Sequence: ATGAGAATAATAATCATTTTTAG Locus tag: Synpcc7942_1463 Name: ompZ Funciton: Predicted zink uptake outer membrane protein
	Synpcc7942_1463	ompZ	Predicted zink uptake outer membrane protein
Position: -84 Score: 5.6 Sequence: ATGATAATGATTATCGTTTATTG Locus tag: slr2043 Name: znuA Funciton: Zinc ABC transporter, substrate-binding protein Locus tag: slr2044 Name: znuB Funciton: Zinc ABC transporter, ATP-binding protein Locus tag: slr2045 Name: znuC Funciton: Zinc ABC transporter, permease protein
	slr2043	znuA	Zinc ABC transporter, substrate-binding protein
	slr2044	znuB	Zinc ABC transporter, ATP-binding protein
	slr2045	znuC	Zinc ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD