Regulog MurR - Staphylococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:	repressor
Biological process:	N-acetylmuramate utilization
Effector:	N-acetylmuramate-6-phosphate
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - RpiR
By effector - N-acetylmuramate-6-phosphate
By pathway - N-acetylmuramate utilization

Statistics of regulated genes
Genome	Genes	Operons
Staphylococcus aureus subsp. aureus N315	4	1
Staphylococcus capitis SK14	4	1
Staphylococcus epidermidis ATCC 12228	4	1
Staphylococcus carnosus subsp. carnosus TM300	4	1
Staphylococcus haemolyticus JCSC1435	4	1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	4	1
Macrococcus caseolyticus JCSC5402

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
SA0184	* Staphylococcus aureus subsp. aureus N315 Site: position = -133 score = 5.41776 sequence = ATATGTAAGATTATTACAATG Gene: SA0184: Outer surface protein of unknown function, N-acetylmuramate-related	* Staphylococcus capitis SK14 Site: position = -65 score = 5.32307 sequence = AATTGTAAACGTTTAATAATA Gene: STACA0001_1175: Outer surface protein of unknown function, N-acetylmuramate-related	* Staphylococcus epidermidis ATCC 12228 Site: position = -66 score = 5.32115 sequence = AATTGTAAACTTGTTGCAATA Gene: SE1888: Outer surface protein of unknown function, N-acetylmuramate-related	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -114 score = 5.56253 sequence = TATTGTAATAAAATTTCAATT Gene: Sca_2140: Outer surface protein of unknown function, N-acetylmuramate-related	* Staphylococcus haemolyticus JCSC1435 Site: position = -91 score = 5.64808 sequence = AATTATAAAAATTATATAATA Gene: SH0743: Outer surface protein of unknown function, N-acetylmuramate-related	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -64 score = 5.5899 sequence = AATTGTAATACTTTTTCATAT Site: position = -105 score = 5.30345 sequence = ATTTGTAATAAAATTTCATTT Gene: SSP0596: Outer surface protein of unknown function, N-acetylmuramate-related	Macrococcus caseolyticus JCSC5402	Outer surface protein of unknown function, N-acetylmuramate-related
murQ	Staphylococcus aureus subsp. aureus N315 Gene: SA0185: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)	Staphylococcus capitis SK14 Gene: STACA0001_1174: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)	Staphylococcus epidermidis ATCC 12228 Gene: SE1889: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_2139: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)	Staphylococcus haemolyticus JCSC1435 Gene: SH0742: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0595: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)	Macrococcus caseolyticus JCSC5402	N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
murT	Staphylococcus aureus subsp. aureus N315 Gene: SA0186: predicted N-acetylmuramate PTS system, IIBC components	Staphylococcus capitis SK14 Gene: STACA0001_1173: predicted N-acetylmuramate PTS system, IIBC components	Staphylococcus epidermidis ATCC 12228 Gene: SE1890: predicted N-acetylmuramate PTS system, IIBC components	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_2138: predicted N-acetylmuramate PTS system, IIBC components	Staphylococcus haemolyticus JCSC1435 Gene: SH0741: predicted N-acetylmuramate PTS system, IIBC components	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0594: predicted N-acetylmuramate PTS system, IIBC components	Macrococcus caseolyticus JCSC5402	predicted N-acetylmuramate PTS system, IIBC components
murR	Staphylococcus aureus subsp. aureus N315 Gene: SA0187: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family	Staphylococcus capitis SK14 Gene: STACA0001_1172: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family	Staphylococcus epidermidis ATCC 12228 Gene: SE1891: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_2137: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family	Staphylococcus haemolyticus JCSC1435 Gene: SH0740: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0593: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family	Macrococcus caseolyticus JCSC5402	predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MurR - Staphylococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --