Regulog TtrR - Pasteurellales

Properties
Regulator type:	Transcription factor
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Statistics of regulated genes
Genome	Genes	Operons
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Actinobacillus succinogenes 130Z
Aggregatibacter aphrophilus NJ8700
Haemophilus ducreyi 35000HP
Haemophilus influenzae Rd KW20
Haemophilus parasuis SH0165
Haemophilus somnus 2336	5	2
Mannheimia succiniciproducens MBEL55E
Pasteurella multocida subsp. multocida str. Pm70	5	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
ttrS	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	* Haemophilus somnus 2336 Site: position = -96 score = 6.36808 sequence = ACCATTGTGGTTTTCCACATAAAA Gene: HSM_1378: Tetrathionate reduction sensor protein TtrS	Mannheimia succiniciproducens MBEL55E	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -64 score = 6.53341 sequence = ACTATTGTGGTTTTCCACATAAAC Gene: PM0724: Tetrathionate reduction sensor protein TtrS	Tetrathionate reduction sensor protein TtrS
ttrR	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336 Gene: HSM_1379: Tetrathionate reduction response regulator protein TtrR, LuxR family	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0725: Tetrathionate reduction response regulator protein TtrR, LuxR family	Tetrathionate reduction response regulator protein TtrR, LuxR family

CRON 2.
ttrB	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	* Haemophilus somnus 2336 Site: position = -179 score = 6.36808 sequence = TTTTATGTGGAAAACCACAATGGT Gene: HSM_1377: Tetrathionate reductase subunit B	Mannheimia succiniciproducens MBEL55E	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -107 score = 6.53341 sequence = GTTTATGTGGAAAACCACAATAGT Gene: PM0723: Tetrathionate reductase subunit B	Tetrathionate reductase subunit B
ttrC	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336 Gene: HSM_1376: Tetrathionate reductase subunit C	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0722: Tetrathionate reductase subunit C	Tetrathionate reductase subunit C
ttrA	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336 Gene: HSM_1375: Tetrathionate reductase subunit A	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0721: Tetrathionate reductase subunit A	Tetrathionate reductase subunit A

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog TtrR - Pasteurellales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --