Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog Svir_39240 - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Actinosynnema mirum DSM 43827
Saccharomonospora viridis DSM 43017 3 1
Saccharopolyspora erythraea NRRL 2338
Acidothermus cellulolyticus 11B
Frankia sp. CcI3
Frankia sp. EAN1pec
Nakamurella multipartita DSM 44233 3 1
Nocardioides sp. JS614
Propionibacterium acnes KPA171202
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Svir_39240
 
Actinosynnema mirum DSM 43827
*
Saccharomonospora viridis DSM 43017

Site:
position = -45
score = 5.71115
sequence = CATGGTTACCTACATGACTAATGAACCCAG

Gene: Svir_39240: Transcriptional regulator, GntR family
 
Saccharopolyspora erythraea NRRL 2338
 
Acidothermus cellulolyticus 11B
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
*
Nakamurella multipartita DSM 44233

Site:
position = -43
score = 5.79386
sequence = ATGGGTACATTAGTGGAGTAACTAACCACT

Gene: Namu_4757: Transcriptional regulator, GntR family
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
Transcriptional regulator, GntR family
lp_2743
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017

Gene: Svir_39230: ABC-type multidrug transport system, ATPase component
 
Saccharopolyspora erythraea NRRL 2338
 
Acidothermus cellulolyticus 11B
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Nakamurella multipartita DSM 44233

Gene: Namu_4756: ABC-type multidrug transport system, ATPase component
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
ABC-type multidrug transport system, ATPase component
lp_2744
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017

Gene: Svir_39220: ABC-type multidrug transport system, permease component
 
Saccharopolyspora erythraea NRRL 2338
 
Acidothermus cellulolyticus 11B
 
Frankia sp. CcI3
 
Frankia sp. EAN1pec
 
Nakamurella multipartita DSM 44233

Gene: Namu_4755: ABC-type multidrug transport system, permease component
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD