Regulog IscR - Psychromonadaceae/Aeromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Psychromonas ingrahamii 37	9	2
Psychromonas sp. CNPT3	9	2
Moritella sp. PE36	9	2
Aeromonas hydrophila subsp. hydrophila ATCC 7966	8	2
Aeromonas salmonicida subsp. salmonicida A449	9	2
Tolumonas auensis DSM 9187	8	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
iscR	* Psychromonas ingrahamii 37 Site: position = -106 score = 6.94469 sequence = TTACTTGACTATTTTTGTCAGGTAT Site: position = -133 score = 6.70842 sequence = TTACCTGACTATTTTTGTCAGGTAT Gene: Ping_1323: Iron-sulfur cluster regulator IscR	* Psychromonas sp. CNPT3 Site: position = -99 score = 6.90697 sequence = TTAGTTGACTAATTTAGTAGGGTAT Gene: PCNPT3_05479: Iron-sulfur cluster regulator IscR	* Moritella sp. PE36 Site: position = -62 score = 7.115 sequence = ATACTTGACCATTTCAGTCGGGTAT Site: position = -87 score = 6.89047 sequence = ATACCTGAGTAAATTAGTCAGGTAT Gene: PE36_21624: Iron-sulfur cluster regulator IscR	* Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -70 score = 7.4528 sequence = ATACTTGACTGATTTAGTCGGGTAT Gene: AHA_1746: Iron-sulfur cluster regulator IscR	* Aeromonas salmonicida subsp. salmonicida A449 Site: position = -70 score = 7.37361 sequence = ATACTTGACTGTTTTAGTCGGGTAT Gene: ASA_2613: Iron-sulfur cluster regulator IscR	* Tolumonas auensis DSM 9187 Site: position = -56 score = 6.06912 sequence = ATACTTGACTGAAAAAGTAGGACAT Gene: Tola_2020: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Psychromonas ingrahamii 37 Gene: Ping_1324: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Psychromonas sp. CNPT3 Gene: PCNPT3_05484: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Moritella sp. PE36 Gene: PE36_21619: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_1747: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_2612: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Tolumonas auensis DSM 9187 Gene: Tola_2019: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Psychromonas ingrahamii 37 Gene: Ping_1325: Iron-sulfur cluster assembly scaffold protein IscU	Psychromonas sp. CNPT3 Gene: PCNPT3_05489: Iron-sulfur cluster assembly scaffold protein IscU	Moritella sp. PE36 Gene: PE36_21614: Iron-sulfur cluster assembly scaffold protein IscU	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_1748: Iron-sulfur cluster assembly scaffold protein IscU	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_2611: Iron-sulfur cluster assembly scaffold protein IscU	Tolumonas auensis DSM 9187 Gene: Tola_2018: Iron-sulfur cluster assembly scaffold protein IscU	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Psychromonas ingrahamii 37 Gene: Ping_1326: Iron binding protein IscA for iron-sulfur cluster assembly	Psychromonas sp. CNPT3 Gene: PCNPT3_05494: Iron binding protein IscA for iron-sulfur cluster assembly	Moritella sp. PE36 Gene: PE36_21609: Iron binding protein IscA for iron-sulfur cluster assembly	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_1749: Iron binding protein IscA for iron-sulfur cluster assembly	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_2610: Iron binding protein IscA for iron-sulfur cluster assembly	Tolumonas auensis DSM 9187 Gene: Tola_2017: Iron binding protein IscA for iron-sulfur cluster assembly	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Psychromonas ingrahamii 37 Gene: Ping_1327: Chaperone protein HscB	Psychromonas sp. CNPT3 Gene: PCNPT3_05499: Chaperone protein HscB	Moritella sp. PE36 Gene: PE36_21604: Chaperone protein HscB	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_1750: Chaperone protein HscB	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_2608: Chaperone protein HscB	Tolumonas auensis DSM 9187 Gene: Tola_2016: Chaperone protein HscB	Chaperone protein HscB
hscA	Psychromonas ingrahamii 37 Gene: Ping_1328: Chaperone protein HscA	Psychromonas sp. CNPT3 Gene: PCNPT3_05504: Chaperone protein HscA	Moritella sp. PE36 Gene: PE36_21599: Chaperone protein HscA	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_1751: Chaperone protein HscA	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_2607: Chaperone protein HscA	Tolumonas auensis DSM 9187 Gene: Tola_2015: Chaperone protein HscA	Chaperone protein HscA
fdx	Psychromonas ingrahamii 37 Gene: Ping_1329: ferredoxin, 2Fe-2S type, ISC system	Psychromonas sp. CNPT3 Gene: PCNPT3_05509: ferredoxin, 2Fe-2S type, ISC system	Moritella sp. PE36 Gene: PE36_21594: ferredoxin, 2Fe-2S type, ISC system	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_1752: ferredoxin, 2Fe-2S type, ISC system	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_2606: ferredoxin, 2Fe-2S type, ISC system	Tolumonas auensis DSM 9187 Gene: Tola_2014: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system
yfhJ	Psychromonas ingrahamii 37 Gene: Ping_1330: putative Fe-S cluster assembly protein	Psychromonas sp. CNPT3 Gene: PCNPT3_05514: putative Fe-S cluster assembly protein	Moritella sp. PE36 Gene: PE36_21589: putative Fe-S cluster assembly protein	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187	putative Fe-S cluster assembly protein
ASA_2609	Psychromonas ingrahamii 37	Psychromonas sp. CNPT3	Moritella sp. PE36	Aeromonas hydrophila subsp. hydrophila ATCC 7966	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_2609: Hypothetical protein	Tolumonas auensis DSM 9187	Hypothetical protein

CRON 2.
erpA	* Psychromonas ingrahamii 37 Site: position = -65 score = 6.69408 sequence = ATACTTGAACTAATTAGTCAGGTAC Gene: Ping_0867: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Psychromonas sp. CNPT3 Site: position = -63 score = 7.09409 sequence = ATAGTTGAACTAATTAGTCGGGTAT Gene: PCNPT3_04157: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Moritella sp. PE36 Site: position = -67 score = 7.19272 sequence = ATAGTTGACTGAATTAGTCAGGTAT Gene: PE36_05088: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -24 score = 6.62404 sequence = ATACTTGAACTGAATGGTCGGGTAT Gene: AHA_3517: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Aeromonas salmonicida subsp. salmonicida A449 Site: position = -78 score = 6.87196 sequence = ATACTTGAACTAAACAGTCGGGTAT Gene: ASA_0800: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Tolumonas auensis DSM 9187 Site: position = -94 score = 7.04922 sequence = ATACTTGAACTGTTTAGTCAGGTAT Gene: Tola_0580: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Psychromonadaceae/Aeromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --