Propagation of NsrR regulog to Idiomarina baltica OS145

Reference regulog properties
Source regulog:	NsrR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Idiomarina baltica OS145
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 51 sites [see more]

Predicted regulatory interactions in *Idiomarina baltica OS145*
	Locus tag	Position	Score	Sequence
Position: -61 Score: 4.3 Sequence: AAATACATTTTAAATGTATGA Locus tag: OS145_08788
	OS145_08788	-61	4.3	AAATACATTTTAAATGTATGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nnrS2
Ortholog function: NnrS protein involved in response to NO
Shewanella sp ANA-3	Shewana3_2362	-46	4.5	AAGTGCAATTATTATGAAGCT
Shewanella denitrificans OS217	Sden_2837	-110	4.4	ACAatCATtaTAaATaCcTGT
Shewanella frigidimarina NCIMB 400	Sfri_3037	-64	5.6	AGATTTATATATTATGCATGT
Shewanella pealeana ATCC 700345	Spea_1227	-35	4.8	AGCTGTATTTTAAATGCGTGT
Shewanella piezotolerans WP3	swp_3404	-39	4.2	AggTaCATtaAAaATaCcTGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --