Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GanR regulog to Bacillus subtilis subsp. subtilis str. 168

Reference regulog properties
Source regulog: GanR - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactan utilization
Effector: Beta-galactosides
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. 168
Orthologous TF(s) BSU34170
Regulated genes 2
Built upon 8 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. 168
Locus tag Position Score Sequence
Position: -109
Score: 5.9
Sequence: TTAGGTAAAAAAATTTACTCTA
Locus tag: BSU34160
BSU34160 -109 5.9 TTAGGTAAAAAAATTTACTCTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ganO
Ortholog function: Arabinogalactan oligomer ABC transporter, binding protein
Bacillus subtilis subsp. subtilis str. 168 BSU34160 -109 5.9 TTAGGTAAAAAAATTTACTCTA
Bacillus pumilus SAFR-032 BPUM_3613 -126 6.8 TTGAGTAAAAAATTTTACTTAA
Bacillus licheniformis DSM 13 BLi04280 -110 5.8 TTTCGTAAAACATTTTACCTGT
Bacillus halodurans C-125 BH2019 -127 5.9 TTTCCGAAAATATTTTACTCAT
Bacillus clausii KSM-K16 ABC3520 -108 7.2 TTAAGTAAAATATTTTACTAAA
Position: -54
Score: 6.6
Sequence: GAAAGTAAAATATTTTACTAAA
Locus tag: BSU34170
BSU34170 -54 6.6 GAAAGTAAAATATTTTACTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ganR
Ortholog function: Transcriptional regulator of galactan utilization operon, LacI family
Bacillus subtilis subsp. subtilis str. 168 BSU34170 -54 6.6 GAAAGTAAAATATTTTACTAAA
Bacillus pumilus SAFR-032 BPUM_3612 -74 5.6 TTTAATAAAAATATTTACTAAT
Bacillus licheniformis DSM 13 BLi04281 -69 7 ATTAGTAAAATATTTTACTAAA