Propagation of LicR regulog to Oceanobacillus iheyensis HTE831

Reference regulog properties
Source regulog:	LicR - Bacillales
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Beta-glucosides utilization
Effector:	HPr, phosphocarrier protein; LicB, lichenan-specific enzyme IIB PTS component
Phylum:	Firmicutes
Propagated regulon:
Target genome	Oceanobacillus iheyensis HTE831
Orthologous TF(s)	OB2764
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Oceanobacillus iheyensis HTE831*
	Locus tag	Position	Score	Sequence
Position: -97 Score: 5.7 Sequence: TTTTCCGTTACACAGCGGAAA Locus tag: OB2760
	OB2760	-97	5.7	TTTTCCGTTACACAGCGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: licB
Ortholog function: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Bacillus clausii KSM-K16	ABC0481	-123	5.4	TTTTCCGTTTATATGGCTAAA
Oceanobacillus iheyensis HTE831	OB2760	-97	5.7	TTTTCCGTTACACAGCGGAAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --